Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsacirc_020135 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Papillary Thyroid Carcinoma (PTC) | ICD-10 | Thyroid and other endocrine glands (D09.3) |
DBLink | PMID | 30988274 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | The normal human astrocyte line SVGp12 and two human glioma cell lines, U87MG and A172 |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ATCCAGATAATGTATGGCTGCG ReverseGGAGGAGGGCAAGAGCTGGA | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Yang, C, Wei, Y, Yu, L, Xiao, Y (2019). Identification of Altered Circular RNA Expression in Serum Exosomes from Patients with Papillary Thyroid Carcinoma by High-Throughput Sequencing. Med. Sci. Monit., 25:2785-2791. |